Table 1: Replicon-associated iterons identified in GR members under study.
GR | Replicase | No. of detected repeats | Iteron sequencea | Length(nt) | Distance from the iteron to rep start codon (bp) | Ref. |
---|---|---|---|---|---|---|
GR22 | RepAci22 pAb242 25 | 4 | TAAGTCTACGTTTTCCCACC(T/C)(T/A) | 22 | 56 | This work |
Rep pD36-4 | 3 | GTCTACGTTTTCCCACC | 17 | 61 | [27] | |
GR23 | RepAci23 pAb242_25 | 5 | TAGGTTTATCGAC(C/T)(C/T)ATAAAA(T/C) | 22 | 71 | This work |
Rep p11921 | 4 | TAGGTTTATCGACCCATAAAAT | 22 | 91 | [11] | |
GR21 | RepAci21 pAb242_12 | 4 | GGTTTGTGCAGC(A/-)TAT(C/T)GAATA | 22 | 221 | This work |
GR4 | RepAci4 pAb242_9 | 4 | ATATGACTACGTTTACCTACCA | 22 | 112 | This work |
RepAci4 pAb844 | 4 | ATATGACTACGTTTACCTACCA | 22 | 107 | [11] |
aDistinctive iteron sequences for each group are informed. Alternative nucleotides at a given position are shown in parenthesis.